Functional Synthetic Biology

Synthetic biology isn't about sequences. Don't agree? Tell me what this is without looking it up: atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttga

Tell you what, I'll give you a hint, make it easy. It's a coding sequence translating to MRKGEELFTGVVPILV. Everybody knows this one, right?

How about this instead?

That's right. That mystery sequence up top is the first 50 bases of BBa_E0040, the widely used iGEM part with a coding sequence for GFPmut3. Now that one, a great many folks working in synthetic biology know, have used in their work, and maybe even have strong opinions about.

Notice that this is a description of biological function: the important thing is that the coding sequence makes a protein that emits a lot of green light when you hit it with a blue laser. There's a sequence in there somewhere but that's not what gets put on the whiteboard or what gets discussed.

Don't get me wrong, sequences are important. But right now we're living with a mis-match in synthetic biology, where most of our discussions about design are about function, but nearly all of our tooling is heavily focused on sequences (e.g., GenBank format), with any information about function tacked on as an afterthought or else confined to specialized databases that each pose their own sui generis integration problem. 

We need a new focus on functional synthetic biology, and that's one of the things we've been working on in the iGEM Engineering Committee. We're trying to change how we do synthetic biology, so that we can pull together the work that lots of people have been doing on calibration, insulation, characterization, context effects, modeling, assembly, etc., in one place and make at least a small class of synthetic biology engineering really simple and predictable.

We aren't there yet, but we've gotten to the point where we think we've figured out some of the important shifts in thinking, representation, and tooling that need to happen in order to make functional synthetic biology possible. If you're interested in this too, I encourage you to read more in our newly available pre-print on Functional Synthetic Biology.