Synthetic biology isn't about sequences. Don't agree? Tell me what this is without looking it up: atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttga
Tell you what, I'll give you a hint, make it easy. It's a coding sequence translating to MRKGEELFTGVVPILV. Everybody knows this one, right?
How about this instead?
Don't get me wrong, sequences are important. But right now we're living with a mis-match in synthetic biology, where most of our discussions about design are about function, but nearly all of our tooling is heavily focused on sequences (e.g., GenBank format), with any information about function tacked on as an afterthought or else confined to specialized databases that each pose their own sui generis integration problem.
We need a new focus on functional synthetic biology, and that's one of the things we've been working on in the iGEM Engineering Committee. We're trying to change how we do synthetic biology, so that we can pull together the work that lots of people have been doing on calibration, insulation, characterization, context effects, modeling, assembly, etc., in one place and make at least a small class of synthetic biology engineering really simple and predictable.
We aren't there yet, but we've gotten to the point where we think we've figured out some of the important shifts in thinking, representation, and tooling that need to happen in order to make functional synthetic biology possible. If you're interested in this too, I encourage you to read more in our newly available pre-print on Functional Synthetic Biology.



